Politicalespionage Homepage
Forum Home Forum Home > Politics > WORLD > Post Reply
  FAQ FAQ  Forum Search   Events   Register Register  Login Login


Post Reply - RNase-Resistant Virus-Like Particles


Post Reply
Name:




Message:

Emoticons
Smile Tongue Wink
Cry Big smile LOL
Dead Embarrassed Confused
Clap Angry Ouch
Star Shocked Sleepy
more...
   NoFollow is applied to all links from this forum
 Enable BBcodes

Message
Topic - RNase-Resistant Virus-Like Particles
Posted: 27 Jan 2022 at 7:51am By reaper
FIG. 1. Armored L-RNA packaging system. Two expressing vectors were constructed, in which the maturase and the coat protein were expressed from one plasmid [pET-28(b)] and the pac site and the six-target chimeric RNA sequence were produced from the second plasmid (pACYCDuet-1). The pac site was located between SARS3 and HCV. 3V armored L-RNA was produced by inducing and expressing the two-plasmid system.
FIG. 2. Characterization of the recombinant RNA packaged in armored L-RNA. Recombinant RNA was isolated from 3V armored L-RNA, fractionated in a denaturing 3% agarose gel, stained with ethidium bromide, and detected by using UV fluorescence. Abbreviations: M, RNA marker; 3V, 3V armored L-RNA recombinant RNA.
FIG. 3. Ethidium bromide-stained 1% agarose gel of RT-PCR amplification products of RNA extracted from 3V armored L-RNA and 3V armored RNA. (A) RT-PCR amplification products of RNA extracted from 3V armored L-RNA. Lane 1, negative control with no template; lanes 2 and 3, negative control without RT; lanes 4 and 5, positive control of pACYC-3V plasmid; lanes 6 to 8, RT-PCR of 3V full-length L-RNA. (B) RT-PCR amplification products of RNA extracted from 3V armored RNA: lane 1, positive control of pET-MS2-3V plasmid using the primers S-SARS1 and HA300RT-A; lane 2, RT-PCR of SARS-CoV1 plus SARS-CoV2 plus SARS-CoV3 plus HCV+HA300 using the primers S-SARS1 and HA300RT-A; lane 3, positive control of pET-MS2-3V plasmid using the primers S-SARS1 and HCV-LAP1; lane 4, RT-PCR of SARS-CoV1 plus SARS-CoV2 plus SARS-CoV3 plus HCV using the primers S-SARS1 and HCV-LAP1; lane 5, positive control of pET-MS2-3V plasmid using the primers S-SARS1 and A-SARS3; lane 6, negative control without RT using primers S-SARS1 and A-SARS3; lane 7, RT-PCR of SARS-CoV1 plus SARS-CoV2 plus SARS-CoV3 using the primers S-SARS1 and A-SARS3; lane 8, RT-PCR of SARS-CoV1 plus SARS-CoV2 using the primers S-SARS1 and A-SARS2; lane 9, positive control of pET-MS2-3V plasmid using the primers S-SARS1 and A-SARS2; lane 10, negative control without reverse transcription using the primers S-SARS1 and A-SARS2.
FIG. 4. Stability study of 3V armored L-RNA. 3V armored L-RNA was added to newborn calf serum to a final concentration of 10,000 and 10,000,000 copies/ml. Samples were incubated at 4°C, 37°C, or room temperature for 0, 1, 2, 4, and 8 weeks. Samples were removed at each time point and were stored at ∼80°C until the completion of the experiment. From these materials, we isolated template RNA for real-time RT-PCR assays. Water was used as a negative control. All RNA templates were assayed in a single run by using an HCV RNA PCR fluorescence quantitative diagnostic kit (Shanghai Kehua Bio-Engineering Co., Ltd.). Real-time RT-PCR was conducted by using LightCycler technology (Roche). The mean for low-copy samples was 67,226 IU/ml (4.83 log10; range, 50,100 to 79,400 IU/ml [range, 4.70 to 4.92 log10]), and the coefficient of variation was 12.9%. The mean for high-copy samples was 29,060,000 IU/ml (7.45 log10; range, 22,900,000 to 41,700,000 IU/ml [range, 7.36 to 7.62 log10]), and the coefficient of variation was 22%.
FIG. 5. Calibration of the real-time RT-PCR assay for HCV, SARS-CoV2, and HA300 (H5N1). First, the quantified 3V armored L-RNA was diluted with newborn calf serum 10-fold serially to obtain 100, 1,000, 10,000, 100,000, and 1,000,000 copies/ml. We used the National Reference material for HCV RNA (GBW09151, 2.26 × 103 IU ml−1 to 4.22 × 107 IU ml−1) to calibrate the serial dilutions of chimeric armored L-RNA and then used the calibrated L-RNA to prepare calibrators for the two real-time RT-PCR assays. From these materials, we isolated RNA template for RT-PCR assays. Newborn calf serum was used as a negative control. Real-time RT-PCR was conducted on a LightCycler thermal cycler (Roche). (A) Log concentration of the international standard for HCV RNA versus the cycle number for the HCV RT-PCR; (B) amplification curve for the HCV RT-PCR assay; (C) amplification curve for the SARS-CoV2 RT-PCR assay; (D) amplification curve for the HA300 (H5N1) RT-PCR assay.
TABLE 1. Primers used for PCR amplification (Table view)
Primer namePrimer sequence (5′ to 3′)a
S-MCCGGGATCCTGGCTATCGCTGTAGGTAGCC
A-MCCCCAAGCTTATGGCCGGCGTCTATTAGTAG
S-SARS1TATCCAAAATGTGACAGAGCCATG
LAP-SARS1ACGCTGAGGTGTGTAGGTGCAGGTAAGCGTAAAACTCATCCAC
A-SARS2TAACCAGTCGGTACAGCTACTAAG
LAP-SARS2AGTTTTACGCTTACCTGCACCTACACACCTCAGCGTTGATATAAAG
A-SARS3ACTACGTGATGAGGAGCGAGAAGAG
LAP-SARS3AGCTGTACCGACTGGTTAACAAATTAAAATGTCTGATAATGGACCCC
LAP-SARS2+ATCAGACATTTTAATTTGTTAACCAGTCGGTACAGCTACTAAG
S-HCVACATGAGGATCACCCATGTGGCGACACTCCACCATAGATCACTC
HCV-LAP1ATGTAAGACCATTCCGGCTCGCAAGCACCCTATCAGGCAGTAC
A-HA300GAATCCGTCTTCCATCTTTCCCCCACAGTACCAAAAGATCTTC
HA300LAPCTGATAGGGTGCTTGCGAGCCGGAATGGTCTTACATAGTGGAG
M+SLAP1ATGGCTCTGTCACATTTTGGATAGAGTAGCTGAGTGCGACCTCCTTAG
M+SLAP2AAGGAGGTCGCACTCAGCTACTCTATCCAAAATGTGACAGAGCCATG
FIVELAP1CATGGGTGATCCTCATGTACTACGTGATGAGGAGCGAGAAGAG
FIVELAP2CGCTCCTCATCACGTAGTACATGAGGATCACCCATGTGGC
OverlapA′CCTTAATTAA CCCACAGTACCAAAAGATCTTCTTG
M300-S′TTGGCCGGCC GAGTCTTCTAACCGAGGTCGAAACG
overlap-ACCCACAGTACCAAAAGATCTTCTTG
M300RT-SGGATTTGTATTCACGCTCACC
HA300RT-ATGGGGATGATCTGAATTTTCTC
a
BamHI, HindIII, FseI, and PacI restriction sites are indicated by underscoring; a C vairiant is indicated in boldface type.
TABLE 2. Thermal cycle conditions for the three different kits used in real-time RT-PCR assays (Table view)
ProgramNo. of cyclesTemp (°C)Incubation time (min:s)Temp transition rate (°C/s)Acquisition mode
HCV     
    115025:0020None
    21942:0020None
    35933:0020None
  5515:002None
  7215:0020None
    442933:0020None
  6045:0020Single
    514030:0020None
H5N1     
    114230:0020None
    21923:0020None
    359210:0020None
  4530:0020None
  721:0020None
    4409210:0020None
  6030:0020Single
    51400:0020None
SARS-Cov2     
    114230:0020None
    21923:0020None
    359210:0020None
  5220:002None
  7230:0020None
 40925:0020None
    4 6030:0020Single
    514010:0020None

Acknowledgments

This study was supported in part by the SEPSDA project of the European Commission (under no. Sp22-CT-2004-003831), the National Natural Science Foundation of China (30371365 and 30571776), and the Capital Medicine Development Foundation of Beijing (2002-3041).

REFERENCES

1.
Argetsinger, J., and G. Gussin.1966. Intact ribonucleic acid from defective particles of bacteriophage R17. J. Mol. Biol.21:421-424. PubMed.
2.
Beld, M., R. Minnaar, J. Weel, C. Sol, M. Damen, H. van der Avoort, P. Wertheim-van Dillen, A. van Breda, and R. Boom.2004. Highly sensitive assay for detection of enterovirus in clinical specimens by reverse transcription-PCR with an armored RNA internal control. J. Clin. Microbiol.42:3059-3064. CrossrefPubMed.
3.
Bressler, A. M., and F. S. Nolte.2004. Preclinical evaluation of two real-time, reverse transcription-PCR assays for detection of the severe acute respiratory syndrome coronavirus. J. Clin. Microbiol.42:987-991. CrossrefPubMed.
4.
Das, A., E. Spackman, D. Senne, J. Pedersen, and D. L. Suarez.2006. Development of an internal positive control for rapid diagnosis of avian influenza virus infections by real-time reverse transcription-PCR with lyophilized reagents. J. Clin. Microbiol.44:3065-3073. CrossrefPubMed.
5.
Donia, D., M. Divizia, and A. Pana.2005. Use of armored RNA as a standard to construct a calibration curve for real-time RT-PCR. J. Virol. Methods126:157-163. PubMed.
6.
Eisler, D. L., A. McNabb, D. R. Jorgensen, and J. L. Isaac-Renton.2004. Use of an internal positive control in a multiplex reverse transcription-PCR to detect West Nile virus RNA in mosquito pools. J. Clin. Microbiol.42:841-843. CrossrefPubMed.
7.
Heisenberg, M.1966. Formation of defective bacteriophage particles by fr amber mutants. J. Mol. Biol.17:136-144. PubMed.
8.
Hietala, S. K., and B. M. Crossley.2006. Armored RNA as virus surrogate in a real-time reverse transcriptase PCR assay proficiency panel. J. Clin. Microbiol.44:67-70. CrossrefPubMed.
9.
Horn, W. T., M. A. Convery, N. J. Stonehouse, C. J. Adams, L. Liljas, S. E. Phillips, and P. G. Stockley.2004. The crystal structure of a high affinity RNA stem-loop complexed with the bacteriophage MS2 capsid: further challenges in the modeling of ligand-RNA interactions. RNA10:1776-1782. PubMed.
10.
Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease.1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene77:61-68. PubMed.
11.
Huang, Q., Y. Cheng, Q. Guo, and Q. Li.2006. Preparation of a chimeric Armored RNA as a versatile calibrator for multiple virus assays. Clin. Chem.52:1446-1448. PubMed.
12.
Konnick, E. Q., S. M. Williams, E. R. Ashwood, and D. R. Hillyard.2005. Evaluation of the COBAS hepatitis C virus (HCV) TaqMan analyte-specific reagent assay and comparison to the COBAS Amplicor HCV Monitor V2.0 and Versant HCV bDNA 3.0 assays. J. Clin. Microbiol.43:2133-2140. CrossrefPubMed.
13.
Lowary, P. T., and O. C. Uhlenbeck.1987. An RNA mutation that increases the affinity of an RNA-protein interaction. Nucleic Acids Res.15:10483-10493. PubMed.
14.
Oliver, A. R., S. F. Pereira, and D. A. Clark.2007. Comparative evaluation of the automated Roche TaqMan real-time quantitative human immunodeficiency virus type 1 RNA PCR assay and the Roche AMPLICOR version 1.5 conventional PCR assay. J. Clin. Microbiol.45:3616-3619. CrossrefPubMed.
15.
Pasloske, B. L., C. R. Walkerpeach, R. D. Obermoeller, M. Winkler, and D. B. DuBois.1998. Armored RNA technology for production of ribonuclease-resistant viral RNA controls and standards. J. Clin. Microbiol.36:3590-3594. CrossrefPubMed.
16.
Pasloske, B. L., D. DuBois, D. Brown, and M. Winkler. April 2001. Ribonuclease-resistant RNA preparation and utilization. U.S. patent 6,214,982.
17.
Pickett, G. G., and D. S. Peabody.1993. Encapsidation of heterologous RNAs by bacteriophage MS2 coat protein. Nucleic Acids Res.21:4621-4626. PubMed.
18.
Romaniuk, P. J., P. Lowary, H. N. Wu, G. Stormo, and O. C. Uhlenbeck.1987. RNA binding site of R17 coat protein. Biochemistry26:1563-1568. PubMed.
19.
Rowsell, S., N. J. Stonehouse, M. A. Convery, C. J. Adams, A. D. Ellington, I. Hirao, D. S. Peabody, P. G. Stockley, and S. E. Phillips.1998. Crystal structures of a series of RNA aptamers complexed to the same protein target. Nat. Struct. Biol.5:970-975. PubMed.
20.
Saldanha, J., and A. Heath.2003. Collaborative study to calibrate hepatitis C virus genotypes 2-6 against the HCV International Standard, 96/790 (genotype 1). Vox Sang84:20-27. PubMed.
21.
Saldanha, J., A. Heath, C. Aberham, J. Albrecht, G. Gentili, M. Gessner, and G. Pisani.2005. World Health Organization collaborative study to establish a replacement WHO international standard for hepatitis C virus RNA nucleic acid amplification technology assays. Vox Sang88:202-204. PubMed.
22.
Scheuermann, R. H., and H. Echols.1984. A separate editing exonuclease for DNA replication: the epsilon subunit of Escherichia coli DNA polymerase III holoenzyme. Proc. Natl. Acad. Sci. USA81:7747-7751. PubMed.
23.
Shiba, T., and Y. Suzuki.1981. Localization of A protein in the RNA-A protein complex of RNA phage MS2. Biochim. Biophys. Acta654:249-255. PubMed.
24.
Stockley, P. G., N. J. Stonehouse, C. Walton, D. A. Walters, G. Medina, J. M. Macedo, H. R. Hill, S. T. Goodman, S. J. Talbot, and H. K. Tewary.1993. Molecular mechanism of RNA-phage morphogenesis. Biochem. Soc. Trans.21:627-633. PubMed.
25.
Stockley, P. G., N. J. Stonehouse, and K. Valegard.1994. Molecular mechanism of RNA phage morphogenesis. Int. J. Biochem.26:1249-1260. PubMed.
26.
Talbot, S. J., S. Goodman, S. R. Bates, C. W. Fishwick, and P. G. Stockley.1990. Use of synthetic oligoribonucleotides to probe RNA-protein interactions in the MS2 translational operator complex. Nucleic Acids Res.18:3521-3528. PubMed.
27.
Valegard, K., J. B. Murray, N. J. Stonehouse, S. van den Worm, P. G. Stockley, and L. Liljas.1997. The three-dimensional structures of two complexes between recombinant MS2 capsids and RNA operator fragments reveal sequence-specific protein-RNA interactions. J. Mol. Biol.270:724-738. PubMed.
28.
WalkerPeach, C. R., M. Winkler, D. B. DuBois, and B. L. Pasloske.1999. Ribonuclease-resistant RNA controls (armored RNA) for reverse transcription-PCR, branched DNA, and genotyping assays for hepatitis C virus. Clin. Chem.45:2079-2085. PubMed.
29.
Witherell, G. W., J. M. Gott, and O. C. Uhlenbeck.1991. Specific interaction between RNA phage coat proteins and RNA. Prog. Nucleic Acid Res. Mol. Biol.40:185-220. PubMed.

Forum Software by Web Wiz Forums® version 12.04
Copyright ©2001-2021 Web Wiz Ltd.

This page was generated in 0.260 seconds.